How to know if a fragment of DNA is coding or non-coding????

for example

5' AACTCCAGTCGCCCATTGCTCAC 3'     is it coding or non-coding??

There is no way of telling for a short stretch of bases like this. Almost any short stretch of DNA can theoretically be translated into a protein. There is no absolute definition of a gene that codes for a protein other than it has to have a start and stop site and code for a protein that can subsequently be shown to be expressed in one or more tissues and to have a function.

Just to add a few bits of detail;

David is quite correct, there is no way of knowing whether or not an arbitrary stretch of DNA codes for protein, because transcription and translation are always dependent on context (ie what kind of cell it is in) and sequences outside the coding regions. These non-coding elements, called promoters and enhancers, fall under the broad umbrella of "regulatory regions" in the genome.

When we look for genes in a genome, we can't look for specific markers, but we can look for patterns to give us clues. For example, one of the most common ways is to search for open reading frames (ORFs). An ORF is a long stretch of DNA which contains no in-frame stop codons, and so can potentially be a protein if a cell expresses it. However, with just that information you cannot call it a gene because you don't know that what you are seeing in just the DNA sequence actually translates to a functional genetic element; it may simply be chance.

Last edited by John Steemson (19th Jun 2012 00:35:25)